we have all become familiar with the use of dna in forensics and paternity disputes.
all humans share 99.9% of their genome in common, but that still leaves plenty room for variation.. geneticists are able to study sections of dna that identify an individual and their closest relatives.
mostly these genetic markers are found in our non-coding dna such as the sections of code known as transposons.. one type of transposon is known as the alu element.
So .. . . . thanks to COFTY'S "Fact #8" post, we have all learned that Jehovah threw some ALU's in our DNA to PROVE that he knew how to cut-and-paste before any of us poor bastards did.
What COFTY failed to point out is that Jehovah also used "emojis" well before humans did. Consider the gene that codes for STUPID_BLANK_STARE:
ATTTAGCCCGGATTTAGCCCGGATA : | ATTAGCCGATCGATGATCGAC
The evidence for God is literally staring you in the face.
i've seen it mentioned by a few on the forum that at some point there was a realization that had they not been born a jw, they never would've converted no matter how many times the jws tried to study with them.
this was my experience too, and i'm wondering how universal it is for those that were born-in but eventually left.
i think i started having this thought (more specifically that if i were not born a jw, i would surely have become an atheist by now) in my late teens.
No way in hell.
after reading several threads on the topics of evolution and theism, i thought i would share what happens to you when you go to college and get a real education on things: you learn that some of the arguments and stands of jehovah's witnesses are moot to begin with.
i never double-checked the "modus operandi" about many things, and boy, did i have some real learning to do.. for instance, why are jehovah's witnesses so against evolution?
it only proves their point.
Great post DAVID JAY!
Welcome.
the so-called 10 commandments are a post-biblical construct.... there is an elohist list at exodus 20 and a yahwist one at exodus 34 that contains such gems as "you shall not cook a kid in its mother’s milk.".
any intelligent adult could create a more useful list of ethical precepts before the end of a coffee break.. it is interesting to compare the satanic temple's seven tenets.
i think you might agree that it makes yahweh's rules look like they were written by a bronze age power-hungry, misogynistic priest.
will the expected heavy snow isolate warwick ny, or brooklyn.
i hope the snow traps the gb showing clearly jehovah's favour and blessing.
Will the expected heavy snow isolate Warwick NY, or Brooklyn
Doesn't look like it. Looks like the worst will be further south, Philly and that area.
part 1 - protein functional redundancypart 2 - dna functional redundancypart 3 - ervspart 4 - smelly genes.
in part 4 we saw that roughly half of the 800 genes in the human genome that code for olfactory receptors are broken remnants of our evolutionary history.
they were vital to our distant ancestors but in humans, as in our primate cousins they have been allowed to fall into disuse as our eyes became more important to our survival than our nose.
This is really interesting. . . .
Next time my wife tries to force vitamin C pills on me, I'll tell her Jehovah's to blame for breaking my GLUO.
part 1 - protein functional redundancy.... part 2 - dna functional redundancy.... imagine you are teacher with suspicions that some of your pupils have been copying from each other.
comparing the correct answers in all of their assignments might not provide conclusive evidence.
they could simply claim they had all carefully revised the same textbooks so it shouldn't be surprising that they all gave the same answers.
Remember when you were a little dub and you would litter the world with your watchtower magazines thinking you making a difference. Your daily DAVID BOWIE THREADS ARE becoming quite redundant complete with the same arrogance of most relentless uber pioneer.
If anyone is truly interested in DAVID BOWIE, GO TO your local RECORD STORE or WATCH A CONCERT VIDEO ON YOUTUBE because this is all becoming quite annoying.
hi all, what do you think about the experience on page 4 of 2016.2 awake?.
maria, who is one of jehovah’s witnesses, was publicly insulted by a prejudiced woman, who caused quite a commotion.
but instead of retaliating, maria calmly continued on her way.
there's a new podcast in town.
right now it's going to be monthly.
please check it out.
I'm definitely going to listen!
Just the article you'll be discussing this episode is amazing:
i intend for this to be one of a series of bite-sized ops on the evidence for evolution.. introduction to dna genes are sequences of dna made up of words (codons) each of which are three letters (bases) long.
there are only four letters in the genetic alphabet (acg&t) each word or codon is the recipe for one amino acid.
there are 20 different amino acids in living organisms.
I retired from working in the county jails as a correction officer. I know one thing everybody has and is working an angle.
Either you are after dirty money or dirty sex. That is always the bottom line.
But if you are after the truth you know there is a God.
Well there ya go folks. Take your protein functional redundancy and shove it.
We be dealing with only THE FACTS here.
